SOLVED: Cutting DNA with a particular restriction enzyme produces DNAfragments that can be separated by?a. recombinant DNAb. gel electrophoresisc. plasmidsd. enzymesc. a genomic library

Part AChoose the steps, which are necessary for cloning procedure.Select all that apply.cut the aardvark DNA with a restriction enzymemix the solutions and add ligasecut the plasmid with another restriction enzymecut the plasmid with the same restriction enzymeadd ligase only to the solution with the aardvark DNAadd ligase only to the solution with the plasmidadd ligase to each mixtureSubmitRequest Answer

SOLVED: The following shows the DNA recognition sequences for three restriction enzymes:BglII: Sau3AI: BamHI: AGATCT 5 - "GATC GGATCC 3. TCTAGA. 3... CTAG; 3,.. CCTAGG ..5" 1A. (1 PL) You are working with a short linear double-stranded DNA fragment that has the sequence shown below. Make boxes that encompass the binding sites for each enzyme and label them.GTTCGCTCGTAGATCTAGCTAGCTACCTAGGATCCACCTAGCTAGATCCCGCTAGATCTCCATCGAT3 CAAGCGACCATCTAGATCCATCGA TCGATCCTACGTCGATCGATCTACCCCGATCTAGACCTAGCTA5IB.

How do restriction enzymes digest? - TimesMojo

PPT - Restriction Enzymes PowerPoint Presentation, free download - ID:1443065

How restriction enzymes, like EcoR1, work. on Make a GIF